
LIN14 RNA Translation and Transcription with LIN4 Silencing. The LIN14 CDR DNA here is "ATGGGCAAAGGCCAACCAAAAGAGCCCAAAATTGAACAGTCTGTGGTCGATTTGTG". Its bases are in the "bass" register. The amino acids that its codons code for are in the middle, and the LIN4 miRNA sequence bases are sprinkled on top.
The amino acids coded here for LIN14 are M-G-K-G-Q-P-K-E-P-K-I-E-Q-S-V-V-D-L: AUG Methionine (M) — start codon GGC Glycine (G) AAA Lysine (K) GGC Glycine (G) CAA Glutamine (Q) CCA Proline (P) AAA Lysine (K) GAG Glutamic Acid (E) CCC Proline (P) AAA Lysine (K) AUU Isoleucine (I) GAA Glutamic Acid (E) CAG Glutamine (Q) UCU Serine (S) GUG Valine (V) GUC Valine (V) GAU Aspartic Acid (D) UUG Leucine (L)
The tones used are all in Just Intonation with the ratios below with their octave displacement given in parentheses. We use the same fundamental for all bases and amino acid tones. I different fundamental is used for the LIN4 miRNA sequence bases.
The bases' tones: Cytosine – 1/1(1), 5/4(–1), 3/2(0); Guanine – 13/8(0), 25/16(1), 169/96(0), 19/8(–1); Uracil – 6/5(1), 13/10(–2), 7/5(1); Adenine – 11/8(0), 10/7(1.5), 12/7(1), 15/8(–1).
Here are the chord tones for the amino acids, given by Just Intonation ratios and their octave displacement in parentheses. Larger amino acids (by molecular weight have larger chords and their voicing is spread or tight depending on their hydrophobicity. Their tonal solidity and n-limit choice is based on their rigidity. In order by appearance in the sequence:
Methionine – 4/3(0), 5/4(1), 6/5(–1), 7/6(–2), 9/8(2); Glycine – 4/3(–1), 5/4(0); Lysine – 5/3(–3), 9/4(2), 15/8(–2), 13/8(–3); Glycine – 4/3(–1), 5/4(0); Glutamine – 4/3(–3), 5/4(–2), 7/6(2); Proline – 5/4(3), 7/6(–2); Lysine – 5/3(–3), 9/4(2), 15/8(–2), 13/8(–3); Glutamic Acid – 9/7(–3), 7/5(–1), 11/9(2); Proline – 5/4(3), 7/6(–2); Lysine – 5/3(–3), 9/4(2), 15/8(–2), 13/8(–3); Isoleucine – 4/3(0), 5/4(1), 6/5(0), 7/6(–2), 9/8(–1); Glutamic Acid – 9/7(–3), 7/5(–1), 11/9(2); Glutamine – 4/3(–3), 5/4(–2), 7/6(2); Serine – 4/3(–3), 5/4(2); Valine – 5/4(1), 6/5(–1), 7/6(0). . Valine – 5/4(1), 6/5(–1), 7/6(0). . Aspartic Acid – 9/7(–3), 7/5(–2), 17/12(2); Leucine – 4/3(0), 5/4(1), 6/5(1), 7/6(2), 9/8(1);
Other Amino Acids that are tonally modeled but don't appear in this piece: Alanine – 4/3(–2), 5/4(1), 6/5(–2); Arginine – 5/3(–1), 9/4(3), 15/8(–2), 13/8(–3), 17/8(2); Asparagine – 4/3(–3), 5/4(–2), 7/6(2); Cysteine – 4/3(0), 6/5(1), 7/6(–1); Histidine – 5/3(–3), 9/4(–2), 15/8(–3), 13/8(2); Phenylalanine – 4/3(0), 5/4(1), 6/5(–1), 7/6(–2), 9/8(2), 11/9(0); Threonine – 4/3(–3), 5/4(–2); Tryptophan – 4/3(–1), 5/4(0), 6/5(1), 7/6(2), 9/8(–2), 11/9(1), 13/10(–1), 29/16(0); Tyrosine – 4/3(–3), 5/4(–3), 6/5(–2), 7/6(2), 9/8(3), 11/9(3), 13/10(–2);
The LIN4 RNA sequence used is "UGUGUAGUGGUUCUUAGGGGU". Cytosine – 1/1(1), 5/4(1), 3/2(0); Guanine – 13/8(0), 25/16(0), 169/96(0), 19/8(0); Uracil – 6/5(1), 13/10(1), 7/5(1); Adenine – 11/8(2), 10/7(2), 12/7(1), 15/8(1).
Cover image is a detail from "Crossroads 2" by Teresa Parod (teresaparod.com).
Love what we do? ➔ become our Open Collective backer
Privacy & cookie policy / Terms and conditions
© ECHOES. All rights reserved / ECHOES.XYZ Limited is a company registered in England and Wales, Registered office at Merston Common Cottage, Merston, Chichester, West Sussex, PO20 1BE
v2.5.19 © ECHOES. All rights reserved.