Ribosome Retune - LIN-14 Coding Region (CDR) Nucleotides and Amino Acids

LIN14 RNA Translation and Transcription with LIN4 Silencing. The LIN14 CDR DNA here is "ATGGGCAAAGGCCAACCAAAAGAGCCCAAAATTGAACAGTCTGTGGTCGATTTGTG". Its bases are in the "bass" register. The amino acids that its codons code for are in the middle, and the LIN4 miRNA sequence bases are sprinkled on top.

The amino acids coded here for LIN14 are M-G-K-G-Q-P-K-E-P-K-I-E-Q-S-V-V-D-L: AUG Methionine (M) — start codon GGC Glycine (G) AAA Lysine (K) GGC Glycine (G) CAA Glutamine (Q) CCA Proline (P) AAA Lysine (K) GAG Glutamic Acid (E) CCC Proline (P) AAA Lysine (K) AUU Isoleucine (I) GAA Glutamic Acid (E) CAG Glutamine (Q) UCU Serine (S) GUG Valine (V) GUC Valine (V) GAU Aspartic Acid (D) UUG Leucine (L)

The tones used are all in Just Intonation with the ratios below with their octave displacement given in parentheses. We use the same fundamental for all bases and amino acid tones. I different fundamental is used for the LIN4 miRNA sequence bases.

The bases' tones: Cytosine – 1/1(1), 5/4(–1), 3/2(0); Guanine – 13/8(0), 25/16(1), 169/96(0), 19/8(–1); Uracil – 6/5(1), 13/10(–2), 7/5(1); Adenine – 11/8(0), 10/7(1.5), 12/7(1), 15/8(–1).

Here are the chord tones for the amino acids, given by Just Intonation ratios and their octave displacement in parentheses. Larger amino acids (by molecular weight have larger chords and their voicing is spread or tight depending on their hydrophobicity. Their tonal solidity and n-limit choice is based on their rigidity. In order by appearance in the sequence:

Methionine – 4/3(0), 5/4(1), 6/5(–1), 7/6(–2), 9/8(2); Glycine – 4/3(–1), 5/4(0); Lysine – 5/3(–3), 9/4(2), 15/8(–2), 13/8(–3); Glycine – 4/3(–1), 5/4(0); Glutamine – 4/3(–3), 5/4(–2), 7/6(2); Proline – 5/4(3), 7/6(–2); Lysine – 5/3(–3), 9/4(2), 15/8(–2), 13/8(–3); Glutamic Acid – 9/7(–3), 7/5(–1), 11/9(2); Proline – 5/4(3), 7/6(–2); Lysine – 5/3(–3), 9/4(2), 15/8(–2), 13/8(–3); Isoleucine – 4/3(0), 5/4(1), 6/5(0), 7/6(–2), 9/8(–1); Glutamic Acid – 9/7(–3), 7/5(–1), 11/9(2); Glutamine – 4/3(–3), 5/4(–2), 7/6(2); Serine – 4/3(–3), 5/4(2); Valine – 5/4(1), 6/5(–1), 7/6(0). . Valine – 5/4(1), 6/5(–1), 7/6(0). . Aspartic Acid – 9/7(–3), 7/5(–2), 17/12(2); Leucine – 4/3(0), 5/4(1), 6/5(1), 7/6(2), 9/8(1);

Other Amino Acids that are tonally modeled but don't appear in this piece: Alanine – 4/3(–2), 5/4(1), 6/5(–2); Arginine – 5/3(–1), 9/4(3), 15/8(–2), 13/8(–3), 17/8(2); Asparagine – 4/3(–3), 5/4(–2), 7/6(2); Cysteine – 4/3(0), 6/5(1), 7/6(–1); Histidine – 5/3(–3), 9/4(–2), 15/8(–3), 13/8(2); Phenylalanine – 4/3(0), 5/4(1), 6/5(–1), 7/6(–2), 9/8(2), 11/9(0); Threonine – 4/3(–3), 5/4(–2); Tryptophan – 4/3(–1), 5/4(0), 6/5(1), 7/6(2), 9/8(–2), 11/9(1), 13/10(–1), 29/16(0); Tyrosine – 4/3(–3), 5/4(–3), 6/5(–2), 7/6(2), 9/8(3), 11/9(3), 13/10(–2);

The LIN4 RNA sequence used is "UGUGUAGUGGUUCUUAGGGGU". Cytosine – 1/1(1), 5/4(1), 3/2(0); Guanine – 13/8(0), 25/16(0), 169/96(0), 19/8(0); Uracil – 6/5(1), 13/10(1), 7/5(1); Adenine – 11/8(2), 10/7(2), 12/7(1), 15/8(1).

Cover image is a detail from "Crossroads 2" by Teresa Parod (teresaparod.com).


Part of this walk

Nature Walk

Nature Walk

Boston
Nature Walk is set in Boston Common and Public Garden. Enter or dwell at any point. It is in three sections: The Great Elm Remembers surrounds The Great Elm in Boston Common and is a meditation on deep memory — both public and private. The Great Elm is no longer standing, yet it endures in our public memory. And for many — those still living and those now passed — it holds personal memories, some of which are woven with its public history. These memories have a power to connect us across time — to a moment, a people, or perhaps a person. In cultures native to this place, the songs of birds are sometimes heard as messages from the spirit world. It seemed fitting to place virtual flocks on this now phantom tree. Inhabiting its absence are sonic populations of local birds. At the tree’s core, these birds resonate wind chime bells to aid their messaging. These in turn resonate down through its roots — and its still- remembering rhizosphere. Gibbons in The Garden presents a tropical forest surrounding the Boston Public Garden Lagoon. There is a tradition at the Garden of planting tropical flora in the summer months. This stems from a Victorian era fascination with the Tropics. We extend that here with recordings of a 130 million year-old forest - among the oldest on earth - that I made in Sabah, Malaysia (Borneo) in the Fall of 2024. Several recordings are set around the Lagoon. A small group of gibbons have broken free to sing throughout the Garden along with a few of their Sumatran cousins. Near the entrance on Charles St, one of the forest soundscapes is mixed with tones derived from a mRNA sequence that is the focus of the next section. Running between the above two biomes between Charles Street and The Great Elm is Ribosome Retune. The name is a play on the focus of this section - exploring Just Intonation on scaffolding of gene expression. This section of the walk dives into a smaller scale of nature, but in a way with significance for Boston. Musically, I was interested in spatial animation of harmonic tunings mirroring natural patterns and processes. I was drawn to Just Intonation (JI) for its clarity and richness of harmony that defies Western tuning’s (12-Tone Equal Temperament) 12-TET categorizations of consonance and dissonance. This unmooring from 12-TET categorical intervals is abundant in the finer details of intervalic combinations and their relation to functional harmony. This more nuanced psychological space is what I wanted to explore. But it’s a vast and chimeric domain. So I sought a natural architecture on which to structure this exploration. I chose gene expression for a couple of reasons. Our recent experience with the Covid-19 pandemic brought broad public awareness (and gratitude!) to the field of biochemistry in its rapid development of mRNA vaccines. Secondly, for this ICMC, it seemed a modest way to honor the enormous contributions to this field from across Boston’s great research institutions. Indeed, last year (2024), Victor Ambros at Massachusetts General Hospital and Gary Ruvkun at Harvard Medical School were awarded the Nobel Prize in Physiology or Medicine for their work on microRNA regulation of mRNA. But what is that? Might it offer a “natural scaffolding” on which to explore JI? This piece is that exploration - a personal adventure to learn about the fundamentals of gene expression voiced through spatial JI. It is an exploration, not an explication. That is, I wouldn’t claim today’s result is a salient “sonification” of RNA transcription and translation. But I’ve tried to represent the biochemical qualities and processes coherently, and - as for any musical work - hopefully in ways that offer worthy listening. This section uses the coded section of the LIN-14 gene (that used in Ambros and Ruvkun's work) to generate tones from its bases and spin out chords of their coded amino acids using the amino acids' molecular weight, polarity, and charge to affect their chords' tones, size, spread, and rotation. The short LIN4 miRNA sequence enters above the walk and moderately stifles amino acid chords in its proximity. More information on the mRNA to Just Intonation mappings is found in their zones: "Ribosome Retune - LIN-14 Coding Region (CDR) Nucleotides and Amino Acids" and "Ribosome Retune - LIN-14 5' Untranslated Region (HTR)". The cover image is from Nature Walk, by Teresa Parod. This painting is one of Teresa's garage door murals in Evanston, IL, USA. See @teresaparod (IG) or teresaparod.com for more work and a map to her ~100 public art works.
free

Privacy & cookie policy / Terms and conditions

© ECHOES. All rights reserved / ECHOES.XYZ Limited is a company registered in England and Wales, Registered office at Merston Common Cottage, Merston, Chichester, West Sussex, PO20 1BE

v2.5.19 © ECHOES. All rights reserved.