
1 sound
This zone mixes insect sounds from Danum Valley with Just Intonation tones taken from the LIN-14 5' Untranslated Region (HTR) for the RNA used elsewhere in this walk.
This RNA sequence is "UAUCGAAGUACCGCGUUCGUGCGCUUUCUGCAGUUAGUCGUCUAUUCCACGCUGGUGUCCGCCGGGCAUUCUUCCAUUCCCAGAU CUGACAAAUCUGCAAUUUUUUUGAAUACCGUUGAGUU". Its Just Intonation intervals, with octave displacement in parenthesis: Cytosine – 1/1(1), 5/4(–1), 3/2(0); Guanine – 13/8(0), 25/16(1), 169/96(0), 19/8(–1); Uracil – 6/5(1), 13/10(–2), 7/5(1); Adenine – 11/8(0), 10/7(1.5), 12/7(1), 15/8(–1).
Cover image is a detail from "Crossroads 2" by Teresa Parod (teresaparod.com).
Love what we do? ➔ become our Open Collective backer
Privacy & cookie policy / Terms and conditions
© ECHOES. All rights reserved / ECHOES.XYZ Limited is a company registered in England and Wales, Registered office at Merston Common Cottage, Merston, Chichester, West Sussex, PO20 1BE
v2.5.15 © ECHOES. All rights reserved.